Rava
□(∀φ(⊨φ⊃φ))
 
 
Právě je offline
1 ban ochrany VAC | Informace
Poslední ban byl uvalen před 1829 dny
᠌Machines linked, connected, and flows interrupted
Subterfuges Dissolved
The things we touch and those we conceive are as improbable as our senses and our reason; we are sure only in our verbal universe, manageable at will—and ineffectual. Being is mute and the mind is garrulous. This is called knowing.

Affirmations
I use Gentoo btw
Marlb gold
Deterritorialized flows of desire ( ...the absolute within a circuit )
C, Shell and Python codifying
Writing
Absolute Zero ( An ineffectual refusal to be born .)
Femboys
Dionysus
Young Sheldon ( Metal flexes beneath vatgrown skin .)
Pornosophical philotheology

Negations (not to be mistaken with negative dialectics)
Mediocrity ( Cogito ergo sum )
Pre-Kantian Dogmatism , the Spectacle totally dogmatic ( except for Spinoza my beloved )
Stability as a biovirus ( ATGACTTATCCACGGTACATTCAGT cellular DNA )
Sanctity as transcendence

Visions of Excess
Love, loving loving love, loves ex nihilo. Hesed.
Přehlídka sběratele
Přehlídka položek
Oblíbená hra
33
Odehrané hodiny
Oblíbená skupina
Steam Universe - Veřejná skupina
Welcome to The Steam Universe
1 759 434
Členové
30 923
Ve hře
320 436
Online
38 441
V konverzaci
Komentáře
Kiro_Luv #FixTF2 29. lis. 2024 v 2.35 
big gay
Adam Smashed 12. srp. 2024 v 6.06 
there are only 2 genders
rednael 5. čvn. 2024 v 10.37 
♥♥♥♥♥♥♥♥♥ young sheldon took hrt