Rava
□(∀φ(⊨φ⊃φ))
 
 
Понастоящем извън линия
1 вписана VAC забрана | Информация
1829 ден(дни) от последна забрана
᠌Machines linked, connected, and flows interrupted
Subterfuges Dissolved
The things we touch and those we conceive are as improbable as our senses and our reason; we are sure only in our verbal universe, manageable at will—and ineffectual. Being is mute and the mind is garrulous. This is called knowing.

Affirmations
I use Gentoo btw
Marlb gold
Deterritorialized flows of desire ( ...the absolute within a circuit )
C, Shell and Python codifying
Writing
Absolute Zero ( An ineffectual refusal to be born .)
Femboys
Dionysus
Young Sheldon ( Metal flexes beneath vatgrown skin .)
Pornosophical philotheology

Negations (not to be mistaken with negative dialectics)
Mediocrity ( Cogito ergo sum )
Pre-Kantian Dogmatism , the Spectacle totally dogmatic ( except for Spinoza my beloved )
Stability as a biovirus ( ATGACTTATCCACGGTACATTCAGT cellular DNA )
Sanctity as transcendence

Visions of Excess
Love, loving loving love, loves ex nihilo. Hesed.
Изложение на постижения
Изложение на „Перфекционист“
Изложение на артикули
Любима игра
33
Изиграни часа
Любима група
Steam Universe - Публична група
Welcome to The Steam Universe
1 759 436
Членове
31 776
В игра
324 799
На линия
38 441
В чата
Коментари
Kiro_Luv #FixTF2 29 ноем. 2024 в 2:35 
big gay
Adam Smashed 12 авг. 2024 в 6:06 
there are only 2 genders
rednael 5 юни 2024 в 10:37 
♥♥♥♥♥♥♥♥♥ young sheldon took hrt